Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pK170.AAV-TRE-Cre-WPRE (Supernova)
(Plasmid #85040)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85040 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-TRE-MCS-WPRE
  • Backbone size w/o insert (bp) 3776
  • Total vector size (bp) 5510
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    nlsCre-WPRE
  • Species
    SV40, P1 phage,Woodchuck hepatitis virus
  • Insert Size (bp)
    1734

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer GAGAACGTATGTCGAGGTAGGCGTGTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For the details of pAAV-TRE-MCS-WPRE, see Hayashi, Y. et al., Science 350, 957-961 (2016).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK170.AAV-TRE-Cre-WPRE (Supernova) was a gift from Takuji Iwasato (Addgene plasmid # 85040 ; http://n2t.net/addgene:85040 ; RRID:Addgene_85040)
  • For your References section:

    Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Luo W, Mizuno H, Iwata R, Nakazawa S, Yasuda K, Itohara S, Iwasato T. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. 10.1038/srep35747 PubMed 27775045