pShuttle CMV RGECO-TnI
(Plasmid #124642)

• Purpose: Myofilament localised red genetically encoded calcium sensor in mammalian expression vector used for AdEasy adenoviral DNA recombination
• Depositing Labs: Matthew Daniels, Paul Robinson, Hugh Watkins
• Publication: Sparrow et al Circ Res. 2019 Feb 8. doi: 10.1161/CIRCRESAHA.118.314600.

Backbone

• Vector backbone: pShuttle CMV
• Backbone manufacturer: Agilent
• Backbone size w/o insert (bp): 7500
• Total vector size (bp): 9390
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RGECO-TnI
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1890
• Entrez Gene: TNNI3 (a.k.a. CMD1FF, CMD2A, CMH7, RCM1, TNNC1, cTnI)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: not1 (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GGTCTATATAAGCAGAGCTG
• 3′ sequencing primer: CTGATCATAATCAGCCATACCAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry