Skip to main content

pShuttle CMV RGECO-TnI
(Plasmid #124642)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124642 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 124642-D50 50 μg of DNA in Tris buffer $495
DNA 124642-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pShuttle CMV
  • Backbone manufacturer
    Agilent
  • Backbone size w/o insert (bp) 7500
  • Total vector size (bp) 9390
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RGECO-TnI
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1890
  • Entrez Gene
    TNNI3 (a.k.a. CMD1FF, CMD2A, CMH7, RCM1, TNNC1, cTnI)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site not1 (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGTCTATATAAGCAGAGCTG
  • 3′ sequencing primer CTGATCATAATCAGCCATACCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pShuttle CMV RGECO-TnI was a gift from Matthew Daniels & Paul Robinson & Hugh Watkins (Addgene plasmid # 124642 ; http://n2t.net/addgene:124642 ; RRID:Addgene_124642)
  • For your References section:

    Measurement of Myofilament-Localised Calcium Dynamics in Adult Cardiomyocytes and the Effect of Hypertrophic Cardiomyopathy Mutations. Sparrow AJ, Sievert K, Patel S, Chang YF, Broyles CN, Brook FA, Watkins H, Geeves MA, Redwood CS, Robinson P, Daniels MJ. Circ Res. 2019 Feb 8. doi: 10.1161/CIRCRESAHA.118.314600. 10.1161/CIRCRESAHA.118.314600 PubMed 30732532