pShuttle CMV RGECO-TnT
(Plasmid
#124643)
-
PurposeMyofilament localised red genetically encoded calcium sensor in mammalian expression vector used for AdEasy adenoviral DNA recombination.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepShuttle CMV
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 9624
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRGECO-TnT
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2124
-
Entrez GeneTNNT2 (a.k.a. CMD1D, CMH2, CMPD2, LVNC6, RCM3, TnTC, cTnT)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site not1 (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTCTATATAAGCAGAGCTG
- 3′ sequencing primer CTGATCATAATCAGCCATACCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pShuttle CMV RGECO-TnT was a gift from Matthew Daniels & Paul Robinson & Hugh Watkins (Addgene plasmid # 124643 ; http://n2t.net/addgene:124643 ; RRID:Addgene_124643) -
For your References section:
Measurement of Myofilament-Localised Calcium Dynamics in Adult Cardiomyocytes and the Effect of Hypertrophic Cardiomyopathy Mutations. Sparrow AJ, Sievert K, Patel S, Chang YF, Broyles CN, Brook FA, Watkins H, Geeves MA, Redwood CS, Robinson P, Daniels MJ. Circ Res. 2019 Feb 8. doi: 10.1161/CIRCRESAHA.118.314600. 10.1161/CIRCRESAHA.118.314600 PubMed 30732532