bPAC-mycHis_pGEM
(Plasmid
#85468)
-
PurposeExpression of photoactivated cyclase bPAC of Beggiatoa sp.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEM
- Backbone size w/o insert (bp) 3152
- Total vector size (bp) 4202
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBacterial Photoactivated Adenylyl Cyclase
-
Alt namebPAC
-
SpeciesSynthetic; Beggiatoa sp.
-
Insert Size (bp)1050
-
GenBank IDGU461307.1
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- Myc (C terminal on insert)
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BsiWI (unknown if destroyed)
- 5′ sequencing primer T7 forward
- 3′ sequencing primer Seq12rv: GTGTAAGTTGGTATTATGTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
bPAC-mycHis_pGEM was a gift from Peter Hegemann (Addgene plasmid # 85468 ; http://n2t.net/addgene:85468 ; RRID:Addgene_85468) -
For your References section:
Light modulation of cellular cAMP by a small bacterial photoactivated adenylyl cyclase, bPAC, of the soil bacterium Beggiatoa. Stierl M, Stumpf P, Udwari D, Gueta R, Hagedorn R, Losi A, Gartner W, Petereit L, Efetova M, Schwarzel M, Oertner TG, Nagel G, Hegemann P. J Biol Chem. 2011 Jan 14. 286(2):1181-8. 10.1074/jbc.M110.185496 PubMed 21030594