bPAC-mycHis_pGEM
(Plasmid #85468)

• Purpose: Expression of photoactivated cyclase bPAC of Beggiatoa sp.
• Depositing Lab: Peter Hegemann
• Publication: Stierl et al J Biol Chem. 2011 Jan 14. 286(2):1181-8.

Backbone

• Vector backbone: pGEM
• Backbone size w/o insert (bp): 3152
• Total vector size (bp): 4202

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bacterial Photoactivated Adenylyl Cyclase
• Alt name: bPAC
• Species: Synthetic; Beggiatoa sp.
• Insert Size (bp): 1050
• GenBank ID: GU461307.1
• Promoter: T7 promoter
• Tags / Fusion Proteins:
  • Myc (C terminal on insert)
  • His (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: BsiWI (unknown if destroyed)
• 5′ sequencing primer: T7 forward
• 3′ sequencing primer: Seq12rv: GTGTAAGTTGGTATTATGTAG

Resource Information

• Supplemental Documents:
  • bPAC-mycHis_pGEM b.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry