pLAS3W-S100P
(Plasmid #125009)

• Purpose: express in mammalian cell
• Depositing Lab: Ruey-Hwa Chen
• Publication: Tan et al Oncogene. 2019 Jul;38(28):5612-5626. doi: 10.1038/s41388-019-0812-8. Epub 2019 Apr 9.

Backbone

• Vector backbone: pLAS3w
• Backbone size w/o insert (bp): 9414
• Total vector size (bp): 9702
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S100P
• Alt name: MIG9
• Species: H. sapiens (human)
• Insert Size (bp): 288
• GenBank ID: NM_005980.3, NM_005980
• Entrez Gene: S100P (a.k.a. MIG9)
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NHE1 (unknown if destroyed)
• 3′ cloning site: ECOR1 (unknown if destroyed)
• 5′ sequencing primer: gctggttattgtgctgtctcat

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry