Skip to main content

sgMTOR_49
(Plasmid #125132)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125132 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 125132-D50 50 μg of DNA in Tris buffer $495
DNA 125132-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MTOR
  • Alt name
    FRAP
  • gRNA/shRNA sequence
    GACTCTGATGCAGAAGGTGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    MTOR (a.k.a. FRAP, FRAP1, FRAP2, RAFT1, RAPT1, SKS)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer hU6-F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgMTOR_49 was a gift from Jin Chen (Addgene plasmid # 125132 ; http://n2t.net/addgene:125132 ; RRID:Addgene_125132)
  • For your References section:

    Disruption of the Scaffolding Function of mLST8 Selectively Inhibits mTORC2 Assembly and Function and Suppresses mTORC2-Dependent Tumor Growth In Vivo. Hwang Y, Kim LC, Song W, Edwards DN, Cook RS, Chen J. Cancer Res. 2019 Jul 1;79(13):3178-3184. doi: 10.1158/0008-5472.CAN-18-3658. Epub 2019 May 13. 10.1158/0008-5472.CAN-18-3658 PubMed 31085701