This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pT7-7 asyn WT
(Plasmid #36046)


Item Catalog # Description Quantity Price (USD)
Plasmid 36046 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Lashuel Lab Plasmid #77

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-7 asyn WT was a gift from Hilal Lashuel (Addgene plasmid # 36046 ; ; RRID:Addgene_36046)
  • For your References section:

    Phosphorylation at Ser-129 but not the phosphomimics S129E/D inhibits the fibrillation of alpha-synuclein. Paleologou KE, Schmid AW, Rospigliosi CC, Kim HY, Lamberto GR, Fredenburg RA, Lansbury PT Jr, Fernandez CO, Eliezer D, Zweckstetter M, Lashuel HA. J Biol Chem. 2008 Jun 13;283(24):16895-905. Epub 2008 Mar 14. 10.1074/jbc.M800747200 PubMed 18343814