pWJB9
(Plasmid #126650)

• Purpose: Expresses AdrA from a modified pLAFR3
• Depositing Lab: Ute Romling
• Publication: Simm et al Mol Microbiol. 2004 Aug;53(4):1123-34. doi: 10.1111/j.1365-2958.2004.04206.x.

Backbone

• Vector backbone: pBAD30
• Backbone manufacturer: Guzman et al, J Bacteriol, 1995, 177(14):4121-30
• Backbone size w/o insert (bp): 4919
• Total vector size (bp): 6070
• Vector type: Bacterial Expression
• Selectable markers: Nalidixic acid resistance

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: optional other temperatures
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: adrA-8xHis/AdrA-8xHis including flanking promoter regions from pBAD30
• Alt name: yaiC
• Species: Salmonella typhimurium ATCC14028 Nal resistant
• Insert Size (bp): 1151
• GenBank ID: EMBL:ACY86975.1
• Promoter: PBAD
• Tag / Fusion Protein:
  • 8xHis (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: cloning primer: ACCCTGCAGGACGAAGCAGGGATTCTGCA
• 3′ sequencing primer: cloning primer: ACCCTGCAGCCAGCGTTTCTGGGTGAGCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry