Skip to main content

pWJB9
(Plasmid #126650)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126650 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBAD30
  • Backbone manufacturer
    Guzman et al, J Bacteriol, 1995, 177(14):4121-30
  • Backbone size w/o insert (bp) 4919
  • Total vector size (bp) 6070
  • Vector type
    Bacterial Expression
  • Selectable markers
    Nalidixic acid resistance

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    optional other temperatures
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    adrA-8xHis/AdrA-8xHis including flanking promoter regions from pBAD30
  • Alt name
    yaiC
  • Species
    Salmonella typhimurium ATCC14028 Nal resistant
  • Insert Size (bp)
    1151
  • GenBank ID
    EMBL:ACY86975.1
  • Promoter PBAD
  • Tag / Fusion Protein
    • 8xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer cloning primer: ACCCTGCAGGACGAAGCAGGGATTCTGCA
  • 3′ sequencing primer cloning primer: ACCCTGCAGCCAGCGTTTCTGGGTGAGCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWJB9 was a gift from Ute Romling (Addgene plasmid # 126650 ; http://n2t.net/addgene:126650 ; RRID:Addgene_126650)
  • For your References section:

    GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Simm R, Morr M, Kader A, Nimtz M, Romling U. Mol Microbiol. 2004 Aug;53(4):1123-34. doi: 10.1111/j.1365-2958.2004.04206.x. 10.1111/j.1365-2958.2004.04206.x PubMed 15306016