pcDNA3.1+ Flag-RAGB99L
(Plasmid #128101)

• Purpose: Expresses constitutively GTP-bound RAGB in mammalian cells in a G418-selectable plasmid
• Depositing Lab: Chi Van Dang
• Publication: Walton et al Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31.

Backbone

• Vector backbone: pcDNA3.1+
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 5359
• Total vector size (bp): 6468
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: The depositing lab used the strain Top10 in their studies.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ras related GTP binding B
• Alt name: RAGB
• Species: H. sapiens (human)
• Insert Size (bp): 1109
• Mutation: Q99L (CAA to CTA)
• GenBank ID: NM_006064
• Entrez Gene: RRAGB (a.k.a. RAGB, bA465E19.1)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: CMV-F (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: BGH-Rev (TAGAAGGCACAGTCGAGG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Flag pLJM1 RagB 99L (David Sabatini, Addgene plasmid #19315) and pcDNA3.1+ (invitrogen)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry