Skip to main content

Flag-APEX2-C Cloning Vector
(Plasmid #128146)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128146 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCD-betaG-FLAG
  • Vector type
    Mammalian Expression
  • Tag / Fusion Protein
    • Flag-APEX2 (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (CSF)
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC (pCD-betaG-FLAG-R)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-APEX2-C Cloning Vector was a gift from Ken-Ichi Takemaru (Addgene plasmid # 128146 ; http://n2t.net/addgene:128146 ; RRID:Addgene_128146)