pSDMA67
(Plasmid #128356)

• Purpose: gRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.
• Depositing Lab: James Fraser
• Publication: Arras et al PLoS One. 2016 Oct 6;11(10):e0164322. doi: 10.1371/journal.pone.0164322. eCollection 2016.

Backbone

• Vector backbone: pBlueScript II SK(-)
• Backbone manufacturer: Stratagene
• Vector type: Unspecified
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Noureothricin (NAT)
• gRNA/shRNA sequence: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
• Species: Synthetic
• Promoter: ACT1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)

Resource Information

• Supplemental Documents:
  • pSDMA67

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: The plasmid contains a 390bp discrepancy in C-terminus of the LacZ Split. This region of the plasmid serves no purpose other than for screening and hosting the MCS used in generating the plasmid. This difference is not expected to affect the final function of this plasmid.