pIE-TGFB2-H6
(Plasmid
#128500)
-
PurposeExpresses human pro-TGFβ2 (from L21 to S414) in insect cells. With C-t H6x tag.
-
Depositing Lab
-
Depositing OrganizationInstitut de Biologia Molecular de Barcelona (IBMB-CSIC)
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIEx
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3843
- Total vector size (bp) 5025
-
Modifications to backboneIntroduction of T after the signal peptide to introduce StuI restriction site = ATGTACAAGCTCACAGTCTTCCTGATGTTCATCGCTTTCGTCATCATCGCTGAGGCCt After AgeI restriction site; introductionn of 6x-His and stop codon = ACCGGTcatcatcaccatcaccatTGA
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTGFB2
-
Alt nameTransforming growth factor beta-2 proprotein
-
Alt nameCetermin
-
Alt nameGlioblastoma-derived T-cell suppressor factor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1182
-
GenBank IDNP_001129071.1
-
Entrez GeneTGFB2 (a.k.a. G-TSF, LDS4, TGF-beta2)
- Promoter IE1
-
Tag
/ Fusion Protein
- His tag (6x) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site StuI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer AGGCCTTGTCTACCTGCAGCACACTC
- 3′ sequencing primer ACCGGTGCTGCATTTGCAAGACTTTAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIE-TGFB2-H6 was a gift from F Xavier Gomis-Ruth (Addgene plasmid # 128500 ; http://n2t.net/addgene:128500 ; RRID:Addgene_128500) -
For your References section:
Recombinant production of human alpha2-macroglobulin variants and interaction studies with recombinant G-related alpha2-macroglobulin binding protein and latent transforming growth factor-beta2. Marino-Puertas L, Del Amo-Maestro L, Taules M, Gomis-Ruth FX, Goulas T. Sci Rep. 2019 Jun 24;9(1):9186. doi: 10.1038/s41598-019-45712-z. 10.1038/s41598-019-45712-z PubMed 31235767