-
Purpose(mNeonGreen)4-tDeg fluorogenic protein
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 129402-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 129402-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Modifications to backboneDeleted CMV promoter
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name(mNeonGreen)-tDeg
-
SpeciesSynthetic
-
Insert Size (bp)3036
-
GenBank IDMN052905 MN052905
- Promoter miniCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CTC AGT ACA ATC TGC TCT GAT GCC GCA TAG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 129402-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 129402-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miniCMV-(mNeonGreen)4-tDeg was a gift from Samie Jaffrey (Addgene plasmid # 129402 ; http://n2t.net/addgene:129402 ; RRID:Addgene_129402) -
For your References section:
Live imaging of mRNA using RNA-stabilized fluorogenic proteins. Wu J, Zaccara S, Khuperkar D, Kim H, Tanenbaum ME, Jaffrey SR. Nat Methods. 2019 Sep;16(9):862-865. doi: 10.1038/s41592-019-0531-7. Epub 2019 Aug 30. 10.1038/s41592-019-0531-7 PubMed 31471614
