-
PurposemCherry mRNA reporter tagged with (F30-2xPepper)10
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-(F30-2xPepper)10
-
SpeciesSynthetic
-
Insert Size (bp)2624
-
GenBank IDMN052904 MN052904
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI for mCherry; XbaI for mCherry-(F30-2xPepper)10 (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-mCherry-(F30-2xPepper)10 was a gift from Samie Jaffrey (Addgene plasmid # 129401 ; http://n2t.net/addgene:129401 ; RRID:Addgene_129401) -
For your References section:
Live imaging of mRNA using RNA-stabilized fluorogenic proteins. Wu J, Zaccara S, Khuperkar D, Kim H, Tanenbaum ME, Jaffrey SR. Nat Methods. 2019 Sep;16(9):862-865. doi: 10.1038/s41592-019-0531-7. Epub 2019 Aug 30. 10.1038/s41592-019-0531-7 PubMed 31471614