Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-pEF1a-FLEX-HA-VHH-KASH-WPRE
(Plasmid #129704)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129704 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HA-VHH-KASH
  • Insert Size (bp)
    663
  • Promoter EF1a
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CAAGCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer CACAAATTTTGTAATCCAGAGGTTG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note: Plasmid contains SFEF141-144GAAG change in the linker region of the GFP nanobody-KASH insert. These differences are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-pEF1a-FLEX-HA-VHH-KASH-WPRE was a gift from Yi Zhang (Addgene plasmid # 129704 ; http://n2t.net/addgene:129704 ; RRID:Addgene_129704)
  • For your References section:

    In vivo nuclear capture and molecular profiling identifies Gmeb1 as a transcriptional regulator essential for dopamine neuron function. Tuesta LM, Djekidel MN, Chen R, Lu F, Wang W, Sabatini BL, Zhang Y. Nat Commun. 2019 Jun 7;10(1):2508. doi: 10.1038/s41467-019-10267-0. 10.1038/s41467-019-10267-0 PubMed 31175277