Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMSCVbsd-PPARD-T261R-V279R
(Plasmid #130739)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130739 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PPARD T261R-V279R
  • Species
    H. sapiens (human)
  • Mutation
    T261R-V279R
  • Entrez Gene
    PPARD (a.k.a. FAAR, NR1C2, NUC1, NUCI, NUCII, PPARB)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pMSCVseqfw (CCCTTGAACCTCCTCGTTCGACC)
  • 3′ sequencing primer pMSCVseqrv (GAGACGTGCTACTTCCATTTGTC)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Generated by PCR mutagenesis. Please visit https://www.biorxiv.org/content/10.1101/525576v2 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCVbsd-PPARD-T261R-V279R was a gift from Till Adhikary (Addgene plasmid # 130739 ; http://n2t.net/addgene:130739 ; RRID:Addgene_130739)
  • For your References section:

    PPARβ/δ recruits NCOR and regulates transcription reinitiation. Legrand N, Bretscher CL, Zielke S, Wilke B, Daude M, Fritz B, Diederich WE, Adhikary T. BioRxiv 10.1101/525576