Skip to main content

PX458-3xHA-FnCas9
(Plasmid #130969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130969 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 130969-D50 50 μg of DNA in Tris buffer $495
DNA 130969-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PX458
  • Backbone size w/o insert (bp) 5023
  • Total vector size (bp) 10091
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FnCas9
  • Alt name
    FnCas9b
  • Species
    Synthetic; Francisella tularensis subsp. novicida
  • Insert Size (bp)
    5068
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3xHA-NLS (N terminal on insert)
    • NLS-T2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer CBA Forward 5' CTCCGGGCTGTAATTAGCTG 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FnCas9 gene was subcloned from PX408, a gift from Feng Zhang

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-3xHA-FnCas9 was a gift from Debojyoti Chakraborty (Addgene plasmid # 130969 ; http://n2t.net/addgene:130969 ; RRID:Addgene_130969)
  • For your References section:

    Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Acharya S, Mishra A, Paul D, Ansari AH, Azhar M, Kumar M, Rauthan R, Sharma N, Aich M, Sinha D, Sharma S, Jain S, Ray A, Jain S, Ramalingam S, Maiti S, Chakraborty D. Proc Natl Acad Sci U S A. 2019 Oct 15;116(42):20959-20968. doi: 10.1073/pnas.1818461116. Epub 2019 Sep 30. 10.1073/pnas.1818461116 PubMed 31570623