Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62731)


Item Catalog # Description Quantity Price (USD)
Plasmid 62731 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5562
  • Total vector size (bp) 9822
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    CAS9 from Streptococcus pyogenes serotype M1
  • Species
    Streptococcus pyogenes serotype M1
  • Insert Size (bp)
  • Mutation
    Codon optimazed for e.coli
  • GenBank ID
    GI:81533697 Q99ZW2
  • Promoter T7
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • His tag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATCGAGATCTCGATCCCGCG
  • 3′ sequencing primer TTTCAGCAAAAAACCCCTCAAGACC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SP-Cas9 was a gift from Niels Geijsen (Addgene plasmid # 62731 ; ; RRID:Addgene_62731)
  • For your References section:

    Efficient Intracellular Delivery of Native Proteins. D'Astolfo DS, Pagliero RJ, Pras A, Karthaus WR, Clevers H, Prasad V, Lebbink RJ, Rehmann H, Geijsen N. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. 10.1016/j.cell.2015.03.028 PubMed 25910214