pAAV-CaMKIIa-mScarlet
(Plasmid #131000)

• Purpose: AAV vector to drive the expression of mScarlet under the control of CamKIIa promoter
• Depositing Lab: Karl Deisseroth
• Publication: Marshel et al Science. 2019 Aug 9;365(6453). pii: science.aaw5202. doi: 10.1126/science.aaw5202. Epub 2019 Jul 18.

Don’t see the serotype you want?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-MCS
• Backbone manufacturer: Stratagene
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mScarlet
• Species: Synthetic
• Promoter: CaMKIIa

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTGGATGCTGACGAAGGCTCG
• 3′ sequencing primer: GAATACCAGTCAATCTTTCAC

Resource Information

• Supplemental Documents:
  • pAAV-CaMKIIa-mScarlett-WPRE.gb
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for AAV8 (Catalog # 131000-AAV8)

Purpose

Ready-to-use AAV8 particles produced from pAAV-CaMKIIa-mScarlet (#131000). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-mScarlet plasmid DNA.

CamKIIa-driven expression of mScarlet. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV8
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: mScarlet

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.