pRS0035
(Plasmid
#131125)
-
PurposeMammalian Target-AID expression vector
-
Depositing Lab
-
Depositing OrganizationThe University of Tokyo
Located in Japan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131125 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 131125-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 131125-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 3376
- Total vector size (bp) 8752
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenCas9-PmCDA1-UGI
-
Alt nameTarget-AID
-
SpeciesSynthetic
-
Insert Size (bp)5376
-
MutationD10A in SpCas9
- Promoter CMV promoter
-
Tags
/ Fusion Proteins
- UGI (C terminal on insert)
- PmCDA1 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer CTGGCAACTAGAAGGCACAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhttps://www.addgene.org/79620/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/729269v1 for bioRxiv preprint.
DNA (Catalog # 131125-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 131125-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS0035 was a gift from Nozomu Yachie (Addgene plasmid # 131125 ; http://n2t.net/addgene:131125 ; RRID:Addgene_131125) -
For your References section:
Base editors for simultaneous introduction of C-to-T and A-to-G mutations. Sakata RC, Ishiguro S, Mori H, Tanaka M, Tatsuno K, Ueda H, Yamamoto S, Seki M, Masuyama N, Nishida K, Nishimasu H, Arakawa K, Kondo A, Nureki O, Tomita M, Aburatani H, Yachie N. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0509-0. doi: 10.1038/s41587-020-0509-0. 10.1038/s41587-020-0509-0 PubMed 32483365