Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRS0045
(Plasmid #131124)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131124 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 6480
  • Total vector size (bp) 9856
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TadA-linker(32aa)-TadA*(7.10)-linker(32aa)-nCas9-PmCDA1-UGI
  • Alt name
    Target-ACE
  • Species
    Synthetic
  • Insert Size (bp)
    6480
  • Mutation
    A262T, R324L, S409I, E480K, E543D, M694I, E1219V in TadA, D10A in SpCas9
  • Promoter CMV promoter
  • Tags / Fusion Proteins
    • TadA (N terminal on insert)
    • PmCDA1 (C terminal on insert)
    • UGI (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer CTGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    https://www.addgene.org/102919/

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/729269v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS0045 was a gift from Nozomu Yachie (Addgene plasmid # 131124 ; http://n2t.net/addgene:131124 ; RRID:Addgene_131124)
  • For your References section:

    Base editors for simultaneous introduction of C-to-T and A-to-G mutations. Sakata RC, Ishiguro S, Mori H, Tanaka M, Tatsuno K, Ueda H, Yamamoto S, Seki M, Masuyama N, Nishida K, Nishimasu H, Arakawa K, Kondo A, Nureki O, Tomita M, Aburatani H, Yachie N. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0509-0. doi: 10.1038/s41587-020-0509-0. 10.1038/s41587-020-0509-0 PubMed 32483365