pCDEF3-vhs
(Plasmid
#131696)
-
Purposeexpresses vhs in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDEF
- Total vector size (bp) 6776
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namevhs
-
SpeciesHSV-1
-
Insert Size (bp)1469
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer gcgatgcaatttcctcattt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGlaunsinger Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/585984v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDEF3-vhs was a gift from Britt Glaunsinger (Addgene plasmid # 131696 ; http://n2t.net/addgene:131696 ; RRID:Addgene_131696) -
For your References section:
Xrn1 activity broadly represses RNA polymerase II occupancy at mammalian but not viral promoters during herpesvirus infection. Hartenian EN, Glaunsinger BA. bioRxiv 585984 10.1101/585984