Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #137730)


Item Catalog # Description Quantity Price (USD)
Plasmid 137730 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size (bp) 10963
  • Modifications to backbone
    A monomeric red fluorescent protein (mRFP) sequence driven by a bacterial promoter is cloned into the stuffer region of the lentiGuide-Puro-P2A-EGFP vector (#137729), enabled as a simple visual quality control step for the gRNA cloning efficiency.
  • Vector type
    Mammalian Expression, Bacterial Expression, Mouse Targeting, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Best to use 32°C for sgRNA library cloning into the linearized vector
  • Copy number

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT (hU6-F)
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (WPRE-R)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

LentiGuide-Puro-P2A-GFP_mRFPstuf vector was generated from the lentiGuide-Puro-P2A-GFP vector. This construct has RFP driven by a bacterial promotor in the stuffer. The stuffer is supposed to be replaced by a gRNA when a CRISPR library is cloned into the CRISPR plasmid. If the BsmBI digestion of the plasmid, and excision of the stuffer, is not optimal the subsequent CRISPR library could be contaminated by constructs containing the stuffer instead of the intended gRNAs. The bacterial RFP cassette in the stuffer enables rapid identification of bacterial colonies carrying constructs with stuffer (bacteria are red) and colonies without the stuffer (bacteria are white). This can be used as a simple visual quality control step for the gRNA cloning efficiency.

LentiGuide-Puro-P2A-GFP_mRFPstuf vector was generated from the lentiGuide-Puro-P2A-GFP vector (#137729). This construct has RFP driven by a bacterial promotor in the stuffer (a kind gift from Dr. Erik Holmgren).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiGuide-Puro-P2A-EGFP_mRFPstuf was a gift from Fredrik Wermeling (Addgene plasmid # 137730 ; ; RRID:Addgene_137730)
  • For your References section:

    IL-4 controls activated neutrophil FcgammaR2b expression and migration into inflamed joints. Panda SK, Wigerblad G, Jiang L, Jimenez-Andrade Y, Iyer VS, Shen Y, Boddul SV, Guerreiro-Cacais AO, Raposo B, Kasza Z, Wermeling F. Proc Natl Acad Sci U S A. 2020 Jan 24. pii: 1914186117. doi: 10.1073/pnas.1914186117. 10.1073/pnas.1914186117 PubMed 31980518