Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LentiGuide-Puro-P2A-EGFP_mRFPstuf
(Plasmid #137730)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 137730 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiGuide-Puro-P2A-EGFP
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size (bp) 10963
  • Modifications to backbone
    A monomeric red fluorescent protein (mRFP) sequence driven by the lac promoter was cloned into the stuffer region of the lentiGuide-Puro-P2A-EGFP vector (#137729). Furthermore, a unique EcoRI site was introduced following the sgRNA scaffold.
  • Vector type
    Mammalian Expression, Bacterial Expression, Mouse Targeting, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Best to use 32°C for sgRNA library cloning into the linearized vector
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG
  • 3′ sequencing primer CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

LentiGuide-Puro-P2A-GFP_mRFPstuf was generated from the lentiGuide-Puro-P2A-GFP (#137729), which was generated from lentiGuide-Puro (#52963).
The plasmid has mRFP driven by the bacterial lac promotor in the stuffer (the mRFP cassette was a kind gift from Dr. Erik Holmgren). The stuffer, 2839 bp, is excised by BsmBI digestion and replaced by a CRISPR library (or individual gRNA spacers). If the BsmBI digestion and the subsequent cloning is inadequate, the resulting CRISPR library can be contaminated by plasmids containing the stuffer instead of gRNAs. The bacterial mRFP cassette in the stuffer enables rapid identification of bacterial colonies carrying plasmids with retained stuffer (bacteria are red) and colonies without the stuffer (bacteria are white). This can be used as a simple visual quality control step for the gRNA cloning efficiency, as well as guide the selection of bacterial colonies where the stuffer has been excised.
A unique EcoRI site was introduced directly following the sgRNA scaffold, facilitating cloning in this region (introducing UMIs, introducing mutations in the sgRNA scaffold, etc).
The plasmid contains both PuroR and EGFP, enabling the selection of successfully infected cells based on both these selection markers. We typically add a pre-determined dose of puromycin (~5-15ug/ml) 24h after infection, using non-infected cells as controls for the efficiency of the selection. After 24-48h selection all non-infected control cells are typically dead, and the infected cells are ~100% EGFP positive. The EGFP signal can also be used for the simple determination of MOI of the viral preparation.
The provided sequencing primers are the primers traditionally used for NGS sequencing of gRNA representation in lentiGuide-Puro (#52963). This primer pair can also be used for Sanger sequencing the insert, amplifying the DNA sample (60oC annealing temp), and sequencing the ~300bp amplicon using the reversed primer. The forward primer is too close to the gRNA sequence for Sanger sequence. 5’-TGTAAACACAAAGATATTAGTACAAAATACGTGAC-3´ can be used as an alternative forward primer, resulting in a larger amplicon, better suited for Sanger sequencing.

LentiGuide-Puro-P2A-GFP_mRFPstuf vector was generated from the lentiGuide-Puro-P2A-GFP vector (#137729). This construct has RFP driven by a bacterial promotor in the stuffer (a kind gift from Dr. Erik Holmgren).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiGuide-Puro-P2A-EGFP_mRFPstuf was a gift from Fredrik Wermeling (Addgene plasmid # 137730 ; http://n2t.net/addgene:137730 ; RRID:Addgene_137730)
  • For your References section:

    IL-4 controls activated neutrophil FcgammaR2b expression and migration into inflamed joints. Panda SK, Wigerblad G, Jiang L, Jimenez-Andrade Y, Iyer VS, Shen Y, Boddul SV, Guerreiro-Cacais AO, Raposo B, Kasza Z, Wermeling F. Proc Natl Acad Sci U S A. 2020 Jan 24. pii: 1914186117. doi: 10.1073/pnas.1914186117. 10.1073/pnas.1914186117 PubMed 31980518