Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LentiGuide Puro-P2A-EGFP
(Plasmid #137729)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 137729 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiGuide-Puro (Plasmid #52963)
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size (bp) 10183
  • Modifications to backbone
    Mammalian codon-optimized EGFP sequence is cloned by the P2A linker into the C-terminal end of puromycin cassette driven by EF-1a promoter of the lentiGuide-Puro vector
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT (hU6-F)
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (WPRE-R)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiGuide Puro-P2A-EGFP was a gift from Fredrik Wermeling (Addgene plasmid # 137729 ; http://n2t.net/addgene:137729 ; RRID:Addgene_137729)
  • For your References section:

    IL-4 controls activated neutrophil FcgammaR2b expression and migration into inflamed joints. Panda SK, Wigerblad G, Jiang L, Jimenez-Andrade Y, Iyer VS, Shen Y, Boddul SV, Guerreiro-Cacais AO, Raposo B, Kasza Z, Wermeling F. Proc Natl Acad Sci U S A. 2020 Jan 24. pii: 1914186117. doi: 10.1073/pnas.1914186117. 10.1073/pnas.1914186117 PubMed 31980518