-
Purpose(Empty Backbone) For simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiGuide-Puro (Plasmid #52963)
-
Backbone manufacturerFeng Zhang Lab
- Backbone size (bp) 10183
-
Modifications to backboneMammalian codon-optimized EGFP sequence is cloned by the P2A linker into the C-terminal end of puromycin cassette driven by EF-1a promoter of the lentiGuide-Puro vector
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral, CRISPR, Synthetic Biology
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (hU6-F)
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (WPRE-R) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byThe original lentiGuide-Puro plasmid (#52963) was obtained from Addgene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiGuide Puro-P2A-EGFP was a gift from Fredrik Wermeling (Addgene plasmid # 137729 ; http://n2t.net/addgene:137729 ; RRID:Addgene_137729) -
For your References section:
IL-4 controls activated neutrophil FcgammaR2b expression and migration into inflamed joints. Panda SK, Wigerblad G, Jiang L, Jimenez-Andrade Y, Iyer VS, Shen Y, Boddul SV, Guerreiro-Cacais AO, Raposo B, Kasza Z, Wermeling F. Proc Natl Acad Sci U S A. 2020 Jan 24. pii: 1914186117. doi: 10.1073/pnas.1914186117. 10.1073/pnas.1914186117 PubMed 31980518