pMini-CAAGs::RFP-DR48
(Plasmid #132640)

• Purpose: Fluorescent reporter to quantify elicitation of the strand annealing mediated repair pathway
• Depositing Lab: Stephen Ekker
• Publication: Wierson et al CRISPR J. 2019 Dec;2(6):417-433. doi: 10.1089/crispr.2019.0026. Epub 2019 Nov 19.

Backbone

• Vector backbone: pkTol2C-EGFP
• Backbone manufacturer: Karl Clark
• Backbone size w/o insert (bp): 3711
• Total vector size (bp): 4529
• Modifications to backbone: Removed EGFP Inserted mRFP Inserted Kozak Sequence
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mRFP
• Alt name: monomeric derviavtive of Red Fluorescent Protein
• Alt name: RFP
• Species: Entacmaea quadricolor
• Insert Size (bp): 804
• Mutation: Contains a 92bp insertion interrupting the open reading frame
• Promoter: Chicken B-actin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (destroyed during cloning)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: gcaacgtgctggttattgtg
• 3′ sequencing primer: aaaAGATCTtcaattaagtttgtgccccagt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The broken RFP insert was derived from Jeff Essner's lab at Iowa State who is the co-corresponding author on the manuscript this construct is from. The broken RFP was used to establish a stable transgenic zebrafish line and the broken RFP was adapted for this plasmid such that it can be used in cell systems.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct contains Tol2 ITRs and can be used to establish a stable cell line via Tol2 transposition.