-
PurposePrime editing in mammalian cells
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 132777-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 132777-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPick pink/red colonies. Growth at 30C helps promote plasmid stability.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExchangeable cassette
-
Alt namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)821
-
MutationSee manuscript
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BsaI sites are located at positions 245 and 1070.
Please note that bacterial colonies for this plasmid often appear pink or red in color because of expression of the RFP insert.
DNA (Catalog # 132777-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 132777-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-pegRNA-GG-acceptor was a gift from David Liu (Addgene plasmid # 132777 ; http://n2t.net/addgene:132777 ; RRID:Addgene_132777) -
For your References section:
Search-and-replace genome editing without double-strand breaks or donor DNA. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR. Nature. 2019 Oct 21. pii: 10.1038/s41586-019-1711-4. doi: 10.1038/s41586-019-1711-4. 10.1038/s41586-019-1711-4 PubMed 31634902