-
PurposeNanoluc complementation assay. Expression of Gαq protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 97 and 98 of Gαq. Addition of the HA epitope at N terminus of Gαq.
-
Depositing Lab
-
Depositing OrganizationUniversite de Liege
Located in Belgium -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134360-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134360-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7021
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGαq-LgB97
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1629
-
GenBank IDNM_002072.5
-
Entrez GeneGNAQ (a.k.a. CMAL, CMC1, G-ALPHA-q, GAQ, SWS)
- Promoter T7
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TTCCCAATCCTCCCCCTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 134360-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134360-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1.Gαq-LgB97 was a gift from Julien Hanson (Addgene plasmid # 134360 ; http://n2t.net/addgene:134360 ; RRID:Addgene_134360) -
For your References section:
A dynamic and screening-compatible nanoluciferase-based complementation assay enables profiling of individual GPCR-G protein interactions. Laschet C, Dupuis N, Hanson J. J Biol Chem. 2019 Mar 15;294(11):4079-4090. doi: 10.1074/jbc.RA118.006231. Epub 2018 Dec 28. 10.1074/jbc.RA118.006231 PubMed 30593506