-
PurposeExpression fusion protein ALKBH5H204A-dCas9 in Mammalian cells
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134784-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134784-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCMV
- Backbone size w/o insert (bp) 3421
- Total vector size (bp) 8752
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameALKBH5 and inactive dCas9
-
SpeciesH. sapiens (human); S. pyogenes
-
Insert Size (bp)5331
-
MutationH204A
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGATCCGCTAGAGATCCGCGGCCGCTAATACGACTCACTATAGGGAGAGCCGCCACCATGGCGGCCGCCAGCG
- 3′ sequencing primer GTGGCGGACTCTGAGGTCCCGGGAGTCTCGCTGCCGCTGTGCCGCCGCATCTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 134784-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134784-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ALKBH5H204A-dCas9 was a gift from Shu-Bing Qian (Addgene plasmid # 134784 ; http://n2t.net/addgene:134784 ; RRID:Addgene_134784) -
For your References section:
Programmable RNA N(6)-methyladenosine editing by CRISPR-Cas9 conjugates. Liu XM, Zhou J, Mao Y, Ji Q, Qian SB. Nat Chem Biol. 2019 Sep;15(9):865-871. doi: 10.1038/s41589-019-0327-1. Epub 2019 Aug 5. 10.1038/s41589-019-0327-1 PubMed 31383972
Map uploaded by the depositor.
