Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

M3D395A-M14-dCas9
(Plasmid #134780)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134780 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CMV
  • Backbone size w/o insert (bp) 3699
  • Total vector size (bp) 9420
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    METTL3/METTL14 methyltransferase domain and inactive dCas9
  • Species
    H. sapiens (human); S. pyogenes
  • Insert Size (bp)
    5721
  • Mutation
    D395A
  • GenBank ID
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M3F, TAATACGACTCACTATAGGGAGAGCCGCCACCATGTTCCCACCTCAG; M14F, AGGTGGCTCCGGAGGGTCTGGTGGATCGGGAACACAGAGC
  • 3′ sequencing primer M3R, CAGACCCTCCGGAGCCACCTGATCCGCCTAAATTCTTAGG; M14R, GTGGCGGACTCTGAGGTCCCGGGAGTCTCGCTGCCGCTTCGGTCAGATTT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    M3D395A-M14-dCas9 was a gift from Shu-Bing Qian (Addgene plasmid # 134780 ; http://n2t.net/addgene:134780 ; RRID:Addgene_134780)
  • For your References section:

    Programmable RNA N(6)-methyladenosine editing by CRISPR-Cas9 conjugates. Liu XM, Zhou J, Mao Y, Ji Q, Qian SB. Nat Chem Biol. 2019 Sep;15(9):865-871. doi: 10.1038/s41589-019-0327-1. Epub 2019 Aug 5. 10.1038/s41589-019-0327-1 PubMed 31383972