FTOH231AD233A-dCas9
(Plasmid
#134782)
-
PurposeExpression fusion protein FTOH231AD233A-dCas9 in Mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134782 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCMV
- Backbone size w/o insert (bp) 3421
- Total vector size (bp) 9085
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFTO and inactive dCas9
-
SpeciesH. sapiens (human); S. pyogenes
-
Insert Size (bp)5664
-
MutationH231A and D233A
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SmaI (not destroyed)
- 5′ sequencing primer AGAGATCCGCGGCCGCTAATACGACTCACTATAGGGAGAGCCGCCACCATGAAGCGC
- 3′ sequencing primer GGTCCCGGGAGTCTCGCTGCCGCTGGGTTTTGCTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FTOH231AD233A-dCas9 was a gift from Shu-Bing Qian (Addgene plasmid # 134782) -
For your References section:
Programmable RNA N(6)-methyladenosine editing by CRISPR-Cas9 conjugates. Liu XM, Zhou J, Mao Y, Ji Q, Qian SB. Nat Chem Biol. 2019 Sep;15(9):865-871. doi: 10.1038/s41589-019-0327-1. Epub 2019 Aug 5. 10.1038/s41589-019-0327-1 PubMed 31383972