pFB1_hMSH2_G674A
(Plasmid #134874)

• Purpose: Expression human MSH2 G674 mutant protein using baculovirus
• Depositing Lab: Peggy Hsieh
• Publication: Geng et al Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15.

Backbone

• Vector backbone: pFastBac 1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4776
• Total vector size (bp): 7502
• Vector type: Insect Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human MSH2_G674A
• Species: H. sapiens (human)
• Insert Size (bp): 2805
• Mutation: Changed Glycine to Alanine at aa#674
• GenBank ID: NM_000251
• Entrez Gene: MSH2 (a.k.a. COCA1, FCC1, HNPCC, HNPCC1, LCFS2, LYNCH1, MMRCS2, MSH-2, hMSH2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH I (not destroyed)
• 3′ cloning site: Xho I (not destroyed)
• 5′ sequencing primer: GAATATTAATAGATCATGG
• 3′ sequencing primer: GCTGCAATAAACAAGTTAACAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry