pCZGY847
(Plasmid #135093)

• Purpose: Transcriptional mcherry reporter of acr-2 (cholinergic) expressing neurons in C. elegans
• Depositing Lab: Yishi Jin
• Publication: Jospin et al PLoS Biol. 2009 Dec;7(12):e1000265. doi: 10.1371/journal.pbio.1000265. Epub 2009 Dec 22.

Backbone

• Vector backbone: pDEST
• Backbone manufacturer: Invitrogen Gateway
• Backbone size w/o insert (bp): 4045
• Total vector size (bp): 5720
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Pacr-2
• Species: C. elegans (nematode)
• Insert Size (bp): 1888
• Promoter: Pacr-2
• Tags / Fusion Proteins:
  • mcherry (C terminal on backbone)
  • unc-10 3'UTR (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AAAAGCAGGCTCCGAATTGG
• 3′ sequencing primer: GGCTGCAGGAATTCGATATCA

Resource Information

• Supplemental Documents:
  • pQA249 Pacr-2_short mCherry unc-10_3UTR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry