pmCherry-SopF
(Plasmid #135174)

• Purpose: Expresses an mCherry-SopF fusion in mammalian cells
• Depositing Lab: Leigh Knodler
• Publication: Lau et al PLoS Pathog. 2019 Jul 24;15(7):e1007959. doi: 10.1371/journal.ppat.1007959. eCollection 2019 Jul.

Backbone

• Vector backbone: pmCherry-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4722
• Total vector size (bp): 5844
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SopF
• Species: Salmonella enterica serovar Typhimurium
• Insert Size (bp): 1125
• Entrez Gene: STM1239 (a.k.a. STM1239)
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: pmCherryC1-F (5' GTTGGACATCACCTCCCACAACGAG 3')

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry