HsTPC2-EYFP
(Plasmid #135194)

• Purpose: Expresses tagged TPC2 in mammalian cells
• Depositing Lab: Antony Galione
• Publication: Davis et al Curr Biol. 2012 Dec 18;22(24):2331-7. doi: 10.1016/j.cub.2012.10.035. Epub 2012 Nov 21.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 10000
• Modifications to backbone: EYFP replaces EGFP
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TPC2
• Alt name: Two-pore channel 2
• Alt name: Tpcn2
• Species: H. sapiens (human)
• Insert Size (bp): 2448
• GenBank ID: BC063008
• Entrez Gene: TPCN2 (a.k.a. SHEP10, TPC2)
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAACGGGACTTTCCAAAATG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Source Bioscience

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

IMAGE clone: 5214862
Collection ID: IRAT 83e4
GeneBank: BC063008