HsTPC2-EYFP
(Plasmid
#135194)
-
PurposeExpresses tagged TPC2 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Oxford
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 135194-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 135194-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 10000
-
Modifications to backboneEYFP replaces EGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTPC2
-
Alt nameTwo-pore channel 2
-
Alt nameTpcn2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2448
-
GenBank IDBC063008
-
Entrez GeneTPCN2 (a.k.a. SHEP10, TPC2)
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySource Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IMAGE clone: 5214862
Collection ID: IRAT 83e4
GeneBank: BC063008
DNA (Catalog # 135194-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 135194-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HsTPC2-EYFP was a gift from Antony Galione (Addgene plasmid # 135194 ; http://n2t.net/addgene:135194 ; RRID:Addgene_135194) -
For your References section:
NAADP activates two-pore channels on T cell cytolytic granules to stimulate exocytosis and killing. Davis LC, Morgan AJ, Chen JL, Snead CM, Bloor-Young D, Shenderov E, Stanton-Humphreys MN, Conway SJ, Churchill GC, Parrington J, Cerundolo V, Galione A. Curr Biol. 2012 Dec 18;22(24):2331-7. doi: 10.1016/j.cub.2012.10.035. Epub 2012 Nov 21. 10.1016/j.cub.2012.10.035 PubMed 23177477
Map uploaded by the depositor.
