Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJZC533
(Plasmid #135435)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135435 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJW609
  • Total vector size (bp) 8669
  • Vector type
    Yeast Expression
  • Selectable markers
    KanMX (G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Mutation
    codon optimized for S. cerevisiae
  • Promoter pTEF1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGCTGTCGATTCGATACTAACG
  • 3′ sequencing primer AATATCGCACTCACGTAAACACTTAATC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJZC533 was a gift from Jesse Zalatan (Addgene plasmid # 135435 ; http://n2t.net/addgene:135435 ; RRID:Addgene_135435)
  • For your References section:

    CRISPR-Cas-Mediated Chemical Control of Transcriptional Dynamics in Yeast. Cunningham-Bryant D, Sun J, Fernandez B, Zalatan JG. Chembiochem. 2019 Jun 14;20(12):1519-1523. doi: 10.1002/cbic.201800823. Epub 2019 Apr 26. 10.1002/cbic.201800823 PubMed 30710419