Skip to main content

pcDNA3-His:dCas9:nls:10P3
(Plasmid #135982)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135982 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 10792
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9 fused to 10 copies of the P3 coiled-coil
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    5376
  • Mutation
    D10A; H840A in S.pyogenes Cas9
  • GenBank ID
    WP_010922251.1
  • Promoter CMV
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-His:dCas9:nls:10P3 was a gift from Roman Jerala (Addgene plasmid # 135982 ; http://n2t.net/addgene:135982 ; RRID:Addgene_135982)
  • For your References section:

    A tunable orthogonal coiled-coil interaction toolbox for engineering mammalian cells. Lebar T, Lainscek D, Merljak E, Aupic J, Jerala R. Nat Chem Biol. 2020 Jan 6. pii: 10.1038/s41589-019-0443-y. doi: 10.1038/s41589-019-0443-y. 10.1038/s41589-019-0443-y PubMed 31907374