U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA
(Plasmid
#136652)
-
PurposeExpresses St1BE4max-LMD9 in mammalian cells along with its U6-driven sgRNA
-
Depositing Lab
-
Depositing OrganizationUniversite Laval
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 136652-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 136652-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneMSP1594_2x_NLS (Plasmid #110625)
- Total vector size (bp) 8715
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSt1Cas9 LMD-9
-
SpeciesH. sapiens (human), Synthetic
- Promoter CAG
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
- APOBEC-1 (N terminal on insert)
- 2xUGI (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtgggccacaggcctgaag
- 3′ sequencing primer AGCCCTGCTGAAGTCCAACTTGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA for St1Cas9
-
SpeciesH. sapiens (human), Synthetic
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGACTATCAtatgcttacc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameAPOBEC-1
-
SpeciesH. sapiens (human)
-
Entrez GeneAPOBEC1 (a.k.a. APO1, APOBEC-1, BEDP, CDAR1, HEPR)
- Promoter CAG
-
Tag
/ Fusion Protein
- hSt1Cas9 (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaacgtgctggttattgtg
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameUGI
-
SpeciesH. sapiens (human), Synthetic
- Promoter CAG
-
Tag
/ Fusion Protein
- hSt1Cas9 (N terminal on insert)
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAAGTTGGACTTCAGCAGGGCT
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameHA tag
-
SpeciesSynthetic
-
Tag
/ Fusion Protein
- UGI (N terminal on insert)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 136652-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 136652-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA was a gift from Yannick Doyon (Addgene plasmid # 136652 ; http://n2t.net/addgene:136652 ; RRID:Addgene_136652) -
For your References section:
Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Agudelo D, Carter S, Velimirovic M, Duringer A, Rivest JF, Levesque S, Loehr J, Mouchiroud M, Cyr D, Waters PJ, Laplante M, Moineau S, Goulet A, Doyon Y. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. 10.1101/gr.255414.119 PubMed 31900288