pCW57-mCherry-2A-BRD4 Iso AdelCTD
(Plasmid
#137722)
-
PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long isoform missing its C-terminal, P-TEFb interacting domain (CTD)
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCW57-GFP-2A-MCS
- Backbone size w/o insert (bp) 8400
- Total vector size (bp) 10492
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsSlow growing plasmid, may need to incubate for >1 day
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBRD4 long isoform without its C-terminal, P-TEFb interacting domain
-
Alt nameBRD4
-
Alt nameisoform AdelCTD
-
SpeciesH. sapiens (human)
-
MutationTruncated at amino acid 1328
-
GenBank IDNM_058243.2 NP_490597.1
-
Entrez GeneBRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
- Promoter Tight TRE promoter
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGGGACGAGATTGAGAAATCTG
- 3′ sequencing primer CAAATGTGGTATGGCTGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-mCherry-2A-BRD4 Iso AdelCTD was a gift from Scott Floyd (Addgene plasmid # 137722 ; http://n2t.net/addgene:137722 ; RRID:Addgene_137722) -
For your References section:
BRD4 Prevents R-Loop Formation and Transcription-Replication Conflicts by Ensuring Efficient Transcription Elongation. Edwards DS, Maganti R, Tanksley JP, Luo J, Park JJH, Balkanska-Sinclair E, Ling J, Floyd SR. Cell Rep. 2020 Sep 22;32(12):108166. doi: 10.1016/j.celrep.2020.108166. 10.1016/j.celrep.2020.108166 PubMed 32966794