pCW57-mCherry-2A-BRD4 Iso CdelET
(Plasmid
#137723)
-
PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long short missing its extra-terminal domain (ET)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW57-GFP-2A-MCS
- Backbone size w/o insert (bp) 8400
- Total vector size (bp) 8396
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsSlow growing plasmid, may need to incubate for >1 day
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBRD4 short isoform with deleted extra-terminal domain
-
Alt nameBRD4
-
Alt nameisoform CdelET
-
SpeciesH. sapiens (human)
-
MutationDeleted amino acids 600-682
-
GenBank IDNM_014299.2 NP_055114.1
-
Entrez GeneBRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
- Promoter Tight TRE promoter
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGGGACGAGATTGAGAAATCTG
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-mCherry-2A-BRD4 Iso CdelET was a gift from Scott Floyd (Addgene plasmid # 137723 ; http://n2t.net/addgene:137723 ; RRID:Addgene_137723) -
For your References section:
BRD4 Prevents R-Loop Formation and Transcription-Replication Conflicts by Ensuring Efficient Transcription Elongation. Edwards DS, Maganti R, Tanksley JP, Luo J, Park JJH, Balkanska-Sinclair E, Ling J, Floyd SR. Cell Rep. 2020 Sep 22;32(12):108166. doi: 10.1016/j.celrep.2020.108166. 10.1016/j.celrep.2020.108166 PubMed 32966794