pAIO-AsCpf1
(Plasmid
#137846)
-
PurposeAsCpf1 and gRNA expression plasmid for P. falciparum; no selection in parasites.
-
Depositing Lab
-
Depositing OrganizationIowa State University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137846 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 137846-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 137846-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepAIO3
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAsCpf1-NLS-FLAG
-
Alt nameCpf1
-
SpeciesAcidaminococcus sp BV3L6
-
Insert Size (bp)4002
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTAGAAAAGGAATAACTAATATTTTATTTATTATCATTCAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byZetsche et al, Addgene #69982
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 137846-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 137846-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAIO-AsCpf1 was a gift from Josh Beck (Addgene plasmid # 137846 ; http://n2t.net/addgene:137846 ; RRID:Addgene_137846) -
For your References section:
EXP1 is required for organisation of EXP2 in the intraerythrocytic malaria parasite vacuole. Nessel T, Beck JM, Rayatpisheh S, Jami-Alahmadi Y, Wohlschlegel JA, Goldberg DE, Beck JR. Cell Microbiol. 2020 Jan 28:e13168. doi: 10.1111/cmi.13168. 10.1111/cmi.13168 PubMed 31990132