pCMV-HA_N-human Prkd2
(Plasmid
#137850)
-
PurposeExpress Prkd2 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 137850-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 137850-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV-HA-N
- Backbone size w/o insert (bp) 3782
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProtein kinase d2
-
Alt namePrkd2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2637
-
GenBank ID25865
-
Entrez GenePRKD2 (a.k.a. HSPC187, PKD2, nPKC-D2)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site Not1 (unknown if destroyed)
- 5′ sequencing primer ACCGAGATCTCTCGAATGGCCACCGCCCCCTCTTATCC
- 3′ sequencing primer TGGATCCCCGCGGCCTCAGAGAACACTGATGCGCTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 137850-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 137850-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA_N-human Prkd2 was a gift from Bruce Beutler (Addgene plasmid # 137850 ; http://n2t.net/addgene:137850 ; RRID:Addgene_137850) -
For your References section:
Mutual inhibition between Prkd2 and Bcl6 controls T follicular helper cell differentiation. Misawa T, SoRelle JA, Choi JH, Yue T, Wang KW, McAlpine W, Wang J, Liu A, Tabeta K, Turer EE, Evers B, Nair-Gill E, Poddar S, Su L, Ou F, Yu L, Russell J, Ludwig S, Zhan X, Hildebrand S, Li X, Tang M, Murray AR, Moresco EMY, Beutler B. Sci Immunol. 2020 Jan 24;5(43):eaaz0085. doi: 10.1126/sciimmunol.aaz0085. 10.1126/sciimmunol.aaz0085 PubMed 31980486