Skip to main content

pPN458
(Plasmid #137876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137876 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 137876-D50 50 μg of DNA in Tris buffer $495
DNA 137876-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGEP163
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TCF4
  • gRNA/shRNA sequence
    TCGCGCGTGGGGCGGCACTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    TCF4 (a.k.a. CDG2T, E2-2, FCD2, FECD3, ITF-2, ITF2, PTHS, SEF-2, SEF2, SEF2-1, SEF2-1A, SEF2-1B, SEF2-1D, TCF-4, bHLHb19)

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional insert: mRFP-T2A-BlasticidinR

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPN458 was a gift from Lindy Barrett (Addgene plasmid # 137876 ; http://n2t.net/addgene:137876 ; RRID:Addgene_137876)
  • For your References section:

    A multiplexed gRNA piggyBac transposon system facilitates efficient induction of CRISPRi and CRISPRa in human pluripotent stem cells. Hazelbaker DZ, Beccard A, Angelini G, Mazzucato P, Messana A, Lam D, Eggan K, Barrett LE. Sci Rep. 2020 Jan 20;10(1):635. doi: 10.1038/s41598-020-57500-1. 10.1038/s41598-020-57500-1 PubMed 31959800