H513 px330.sgActin.UTR.2
(Plasmid
#138176)
-
PurposeCRISPR SONIC: Encodes codon-optimized SpCas9 and gRNA for targeting 3' UTR of β-actin.
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 138176-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 138176-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 42230)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgActin
-
gRNA/shRNA sequenceCCACCCCCACTCCTAAGAGG
-
SpeciesM. musculus (mouse)
-
Entrez GeneActb (a.k.a. Actx, E430023M04Rik, beta-actin)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6-F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 138176-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 138176-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H513 px330.sgActin.UTR.2 was a gift from Wen Xue (Addgene plasmid # 138176 ; http://n2t.net/addgene:138176 ; RRID:Addgene_138176) -
For your References section:
CRISPR-SONIC: targeted somatic oncogene knock-in enables rapid in vivo cancer modeling. Mou H, Ozata DM, Smith JL, Sheel A, Kwan SY, Hough S, Kucukural A, Kennedy Z, Cao Y, Xue W. Genome Med. 2019 Apr 16;11(1):21. doi: 10.1186/s13073-019-0627-9. 10.1186/s13073-019-0627-9 PubMed 30987660