pcDNA3.1-Hyg-RFPKDEL
(Plasmid #138660)

• Purpose: Reporter plasmid expressing the ER-located RFP
• Depositing Lab: Bertrand Collet
• Depositing Organization: INRAE Jouy-en-Josas
  Located in France
• Publication: Dehler et al J Immunol. 2019 Jul 15;203(2):465-475. doi: 10.4049/jimmunol.1801376. Epub 2019 May 29.

Backbone

• Vector backbone: pcDNA3.1-Hyg
• Backbone manufacturer: Thermofisher
• Backbone size w/o insert (bp): 5570
• Total vector size (bp): 6362
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RFP-KDEL
• Alt name: Red fluorescent protein ER-located
• Species: Synthetic
• Insert Size (bp): 792
• Promoter: CMV
• Tag / Fusion Protein:
  • KDEL (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GGCTAACTAGAGAACCCACTG
• 3′ sequencing primer: GGCAACTAGAAGGCACAGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional References:
Chaumont L, Jouneau L, Huetz F, van Muilekom DR, Peruzzi M, Raffy C, Le Hir J, Minke J, Boudinot P, Collet B. Unexpected regulatory functions of cyprinid Viperin on inflammation and metabolism. BMC Genomics. 2024 Jun 29;25(1):650. doi: 10.1186/s12864-024-10566-x. PMID: 38951796; PMCID: PMC11218377.

Chaumont, L., Peruzzi, M., Huetz, F., Raffy, C., Le Hir, J., Minke, J., Boudinot, P., Collet, B., 2024. Salmonid Double-stranded RNA–Dependent Protein Kinase Activates Apoptosis and Inhibits Protein Synthesis. J. Immunol. https://doi.org/10.4049/JIMMUNOL.2400076 PMID: 39058317

DNA (Catalog # 138660-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 138660-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.