Skip to main content

sgRNA BRCA2 R2842C
(Plasmid #139324)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139324 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 139324-D50 50 μg of DNA in Tris buffer $495
DNA 139324-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    B52 (Addgene #100708)
  • Backbone size w/o insert (bp) 2633
  • Total vector size (bp) 2637
  • Modifications to backbone
    Insertion of the sgRNA at the BbsI cloning site. The BsmBI cloning site is still available to express a second sgRNA.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA to insert BRCA2 R2842C using base editing
  • gRNA/shRNA sequence
    ATATTTCGCAATGAAAGAG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    19
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGTACCTCGAGGAATTCTCTAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA BRCA2 R2842C was a gift from Alberto Ciccia (Addgene plasmid # 139324 ; http://n2t.net/addgene:139324 ; RRID:Addgene_139324)
  • For your References section:

    Detection of Marker-Free Precision Genome Editing and Genetic Variation through the Capture of Genomic Signatures. Billon P, Nambiar TS, Hayward SB, Zafra MP, Schatoff EM, Oshima K, Dunbar A, Breinig M, Park YC, Ryu HS, Tschaharganeh DF, Levine RL, Baer R, Ferrando A, Dow LE, Ciccia A. Cell Rep. 2020 Mar 10;30(10):3280-3295.e6. doi: 10.1016/j.celrep.2020.02.068. 10.1016/j.celrep.2020.02.068 PubMed 32160537