Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

sgRNA BRCA2 V572I
(Plasmid #139321)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 139321 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    B52 (Addgene #100708)
  • Backbone size w/o insert (bp) 2633
  • Total vector size (bp) 2637
  • Modifications to backbone
    Insertion of the sgRNA at the BbsI cloning site. The BsmBI cloning site is still available to express a second sgRNA.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA to insert BRCA2 V572I using base editing
  • gRNA/shRNA sequence
    GCTACAGAATTCTGTGTGG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    19
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGTACCTCGAGGAATTCTCTAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA BRCA2 V572I was a gift from Alberto Ciccia (Addgene plasmid # 139321 ; http://n2t.net/addgene:139321 ; RRID:Addgene_139321)
  • For your References section:

    Detection of Marker-Free Precision Genome Editing and Genetic Variation through the Capture of Genomic Signatures. Billon P, Nambiar TS, Hayward SB, Zafra MP, Schatoff EM, Oshima K, Dunbar A, Breinig M, Park YC, Ryu HS, Tschaharganeh DF, Levine RL, Baer R, Ferrando A, Dow LE, Ciccia A. Cell Rep. 2020 Mar 10;30(10):3280-3295.e6. doi: 10.1016/j.celrep.2020.02.068. 10.1016/j.celrep.2020.02.068 PubMed 32160537