Skip to main content

pEGFP-2xFYVE
(Plasmid #140047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140047 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 140047-D50 50 μg of DNA in Tris buffer $495
DNA 140047-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-C3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 4219
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tandem HRS FYVE domain
  • Alt name
    HGS
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    486
  • Mutation
    two FYVE domains (amino acids 147-223), linked by QGQGS linker
  • GenBank ID
    15239
  • Entrez Gene
    Hgs (a.k.a. Hgr, Hrs, ZFYVE8, tn)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI in backbone/MfeI in insert (destroyed during cloning)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-2xFYVE was a gift from Harald Stenmark (Addgene plasmid # 140047 ; http://n2t.net/addgene:140047 ; RRID:Addgene_140047)
  • For your References section:

    Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells. Gillooly DJ, Morrow IC, Lindsay M, Gould R, Bryant NJ, Gaullier JM, Parton RG, Stenmark H. EMBO J. 2000 Sep 1;19(17):4577-88. doi: 10.1093/emboj/19.17.4577. 10.1093/emboj/19.17.4577 PubMed 10970851