-
PurposeExpresses mCherry-tagged HRS 2xFYVE in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmCherry-C3
-
Backbone manufacturerClontech / in-house cloning
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5210
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametandem HRS FYVE domain
-
Alt nameHGS
-
SpeciesM. musculus (mouse)
-
Mutationtwo FYVE domains (amino acids 147-223), linked by QGQGS linker
-
GenBank ID15239
-
Entrez GeneHgs (a.k.a. H, Hgr, Hrs, ZFYVE8, t, tn)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI in backbone/MfeI in insert (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCherry-2xFYVE was a gift from Harald Stenmark (Addgene plasmid # 140050 ; http://n2t.net/addgene:140050 ; RRID:Addgene_140050) -
For your References section:
WDFY2 restrains matrix metalloproteinase secretion and cell invasion by controlling VAMP3-dependent recycling. Sneeggen M, Pedersen NM, Campsteijn C, Haugsten EM, Stenmark H, Schink KO. Nat Commun. 2019 Jun 28;10(1):2850. doi: 10.1038/s41467-019-10794-w. 10.1038/s41467-019-10794-w PubMed 31253801