Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

GFP-hPIKfyve
(Plasmid #121148)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 121148 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    1-phosphatidylinositol 3-phosphate 5-kinase isoform 2
  • Alt name
    PIKfyve
  • Alt name
    Type III PIP kinase
  • Alt name
    PIP5K3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7026
  • GenBank ID
    NP_055855.2
  • Entrez Gene
    PIKFYVE (a.k.a. CFD, FAB1, HEL37, PIP5K, PIP5K3, ZFYVE29)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-hPIKfyve was a gift from Geert van den Bogaart (Addgene plasmid # 121148 ; http://n2t.net/addgene:121148 ; RRID:Addgene_121148)
  • For your References section:

    The Phosphoinositide Kinase PIKfyve Promotes Cathepsin-S-Mediated Major Histocompatibility Complex Class II Antigen Presentation. Baranov MV, Bianchi F, Schirmacher A, van Aart MAC, Maassen S, Muntjewerff EM, Dingjan I, Ter Beest M, Verdoes M, Keyser SGL, Bertozzi CR, Diederichsen U, van den Bogaart G. iScience. 2019 Jan 25;11:160-177. doi: 10.1016/j.isci.2018.12.015. Epub 2018 Dec 20. 10.1016/j.isci.2018.12.015 PubMed 30612035