-
PurposeExpresses GFP-tagged human PIKfyve in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationRadboud University Nijmegen Medical Centre
Located in Netherlands -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 121148-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 121148-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name1-phosphatidylinositol 3-phosphate 5-kinase isoform 2
-
Alt namePIKfyve
-
Alt nameType III PIP kinase
-
Alt namePIP5K3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7026
-
GenBank IDNP_055855.2
-
Entrez GenePIKFYVE (a.k.a. FAB1, HEL37, PIP5K, PIP5K3, ZFYVE29)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 121148-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 121148-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-hPIKfyve was a gift from Geert van den Bogaart (Addgene plasmid # 121148 ; http://n2t.net/addgene:121148 ; RRID:Addgene_121148) -
For your References section:
The Phosphoinositide Kinase PIKfyve Promotes Cathepsin-S-Mediated Major Histocompatibility Complex Class II Antigen Presentation. Baranov MV, Bianchi F, Schirmacher A, van Aart MAC, Maassen S, Muntjewerff EM, Dingjan I, Ter Beest M, Verdoes M, Keyser SGL, Bertozzi CR, Diederichsen U, van den Bogaart G. iScience. 2019 Jan 25;11:160-177. doi: 10.1016/j.isci.2018.12.015. Epub 2018 Dec 20. 10.1016/j.isci.2018.12.015 PubMed 30612035