GFP-hPIKfyve
(Plasmid #121148)

• Purpose: Expresses GFP-tagged human PIKfyve in mammalian cells.
• Depositing Lab: Geert van den Bogaart
• Publication: Baranov et al iScience. 2019 Jan 25;11:160-177. doi: 10.1016/j.isci.2018.12.015. Epub 2018 Dec 20.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 1-phosphatidylinositol 3-phosphate 5-kinase isoform 2
• Alt name: PIKfyve
• Alt name: Type III PIP kinase
• Alt name: PIP5K3
• Species: H. sapiens (human)
• Insert Size (bp): 7026
• GenBank ID: NP_055855.2
• Entrez Gene: PIKFYVE (a.k.a. CFD, FAB1, HEL37, PIP5K, PIP5K3, ZFYVE29)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry