-
PurposeFluorescent reporter for phosphatidylinositol (3,5)-bisphosphate (PI(3,5)P2). Mouse MCOLN1 residues 1–68 fused to eGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerCloneTech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCOLN1
-
Alt nameMouse MCOLN1 residues 1–68; Mucolipin 1, phosphoinositide binding domain.
-
SpeciesM. musculus (mouse)
-
MutationSynthetic gene, codon optimized for human.
-
GenBank IDNM_053177.1 NM_053177.1
-
Entrez GeneMcoln1 (a.k.a. 2210015I05Rik, TRP, TRPML1, muco, mucolipidin)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCCGCCGGGATCAC
- 3′ sequencing primer CCTCTACAAATGTGGTATGGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mEGFP-PI35P2 was a gift from Geert van den Bogaart (Addgene plasmid # 92419 ; http://n2t.net/addgene:92419 ; RRID:Addgene_92419) -
For your References section:
SWAP70 is a universal GEF-like adapter for tethering actin to phagosomes. Baranov MV, Revelo NH, Verboogen DRJ, Ter Beest M, van den Bogaart G. Small GTPases. 2017 May 10:0. doi: 10.1080/21541248.2017.1328302. 10.1080/21541248.2017.1328302 PubMed 28489960