mEGFP-PI35P2
(Plasmid #92419)

• Purpose: Fluorescent reporter for phosphatidylinositol (3,5)-bisphosphate (PI(3,5)P2). Mouse MCOLN1 residues 1–68 fused to eGFP.
• Depositing Lab: Geert van den Bogaart
• Publication: Baranov et al Small GTPases. 2017 May 10:0. doi: 10.1080/21541248.2017.1328302.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: CloneTech
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MCOLN1
• Alt name: Mouse MCOLN1 residues 1–68; Mucolipin 1, phosphoinositide binding domain.
• Species: M. musculus (mouse)
• Mutation: Synthetic gene, codon optimized for human.
• GenBank ID: NM_053177.1 NM_053177.1
• Entrez Gene: Mcoln1 (a.k.a. 2210015I05Rik, TRPML1, mucolipidin)
• Promoter: CMV
• Tag / Fusion Protein:
  • eGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GCCGCCGGGATCAC
• 3′ sequencing primer: CCTCTACAAATGTGGTATGGC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry